Molgen 4500 Module 4 Homework

MolGen 4500 Module 4 Biotechnology Assignment Cameron Trefny Clicker number: 3CBCE9 DNA sequence: CTGTATCCCGGGTTTTTAATATAAAGGTGT 1. Identify the gene from which the query sequence originates (Name of gene) Homo sapiens collagen, type IV, alpha 5 (COL4A5), RefSeqGene on chromosome X 2. Provide the full protein sequence encoded by the gene. 1 mlinklwlll vtlclteela aageksygkp cggqdcsgsc qcfpekgarg rpgpigiqgp 61 tgpqgftgst glsglkgerg fpgllgpygp kgdkgpmgvp gflgingipg hpgqpgprgp 121 pgldgcngtq gavgfpgpdg ypgllgppgl pgqkgskgdp vlapgsfkgm kgdpglpgld 181 gitgpqgapg fpgavgpagp pglqgppgpp gplgpdgnmg lgfqgekgvk gdvglpgpag 241 pppstgelef mgfpkgkkgs kgepgpkgfp gisgppgfpg lgttgekgek gekgipglpg 301 prgpmgsegv qgppgqqgkk gtlgfpglng fqgiegqkgd iglpgpdvfi didgavisgn 361 pgdpgvpglp glkgdegiqg lrgpsgvpgl palsgvpgal gpqgfpglkg dqgnpgrtti 421 gaaglpgrdg lpgppgppgp pspefetetl hnkesgfpgl rgeqgpkgnl glkgikgdsg 481 fcacdggvpn tgppgepgpp gpwgliglpg lkgargdrgs ggaqgpagap glvgplgpsg 541 pkgkkgepil stiqgmpgdr gdsgsqgfrg vigepgkdgv pglpglpglp gdggqgfpge 601 kglpglpgek ghpgppglpg nglpglpgpr glpgdkgkdg lpgqqglpgs kgitlpciip 661 gsygpsgfpg tpgfpgpkgs rglpgtpgqp gssgskgepg spglvhlpel pgfpgprgek 721 glpgfpglpg kdglpgmigs pglpgskgat gdifgaenga pgeqglqglt ghkgflgdsg 781 lpglkgvhgk pgllgpkger gspgtpgqvg qpgtpgssgp ygikgksglp gapgfpgisg

Unformatted text preview: SHORT ANSWER/ ESSAY What are Northern analyses used for? Describe the steps involved in performing a Northern analysis, and describe how levels of gene expression are determined. 1-1 • In a Northern you are examining RNA expression by probing the filter. The methodology is the same as a Southern, the difference being that you are examining RNA. The quantity of RNA expression can be determined by the intensity of the band, whether it is a radioactive or a fluorescent probe. Of course, you will have to have a control on the gel so that you have something to Describe the basic components for a typical plasmid cloning vector system and the reason/use for those plasmid vector components. 10-1 • multiple restriction sites, an origin of replication site, and selectable markers • Restriction sites: cut the plasmid and foreign DNA with the same enzyme and insert a gene. • Origin of replication: new recombinant genes will be able to replicate and increase in #. The transcriptome of a genome contains more components than the proteome. Explain why this is true. 8-1 • Transcriptome: all the RNA molecules transcribed from a genome • Proteome: all the proteins encoded by the genome • It takes 3 RNA codons to code for one protein, so it is natural to have more transcriptome (RNA molecules) than proteome (proteins). List four uses of PCR 10-3 • Cell free cloning • Identification of restriction enzyme variants • Screening for genetic disorders • Diagnostic screening for infectious organisms • Forensics • paleobiology Compare the transcriptome of an organism with the proteome. What is described by each? 8-2 • Some genes encode non-coding RNA’s that are not translated into proteins • Transcriptome has all RNA transcripts, coding and non-coding • Proteome only has the proteins that result from those transcripts Compare the fields of structural, functional, and comparative genomics. What is the purpose of each? 9-1 • Structural genomics- is concerned with organization and sequence of a genome, • Functional genomics- characterizes what sequences or genes do • Comparative genomics- compares similarities and differences in gene content, function, and organization among genomes of different organisms The haploid human genome contains about 3 × 109 nucleotides. On average, how many DNA fragments would be produced if this DNA was digested with restriction enzyme Pst I (a 6-base cutter)? Rsa I (a 4-base cutter)? How often would an 8-base cutter cleave? 9-2 • 4 base cutter: (1/4)^4= 1/256 bp • Gets cut (3e9)/256= 11,718,750. • 6 base: (1/4)^6= 2.44e-4 (1/5000 bp) • Gets cut (3e9)/5000= 6,000,000 cuts • 8 base: (1/4)^8= 1e-5 (1/10,000 bp) • Gets cut (3e9)/10,000= 30,000 Why are telomeres and centromeres particularly difficult to sequence?...
View Full Document

0 Thoughts to “Molgen 4500 Module 4 Homework

Leave a comment

L'indirizzo email non verrà pubblicato. I campi obbligatori sono contrassegnati *